Echinophyllia sp. sc22
WebExpression of SNAP-Tagged Cox8A in Mammalian cells. Depositor. Ana Egana , New England Biolabs. Insert. Cox8A ( COX8A Human) Use. Tags. SNAP-tag (SNAPf) Expression. WebLight: Plant Echinops in Full sun. Soil: Echinops can handle many different types of soils so long as they are well drained. Well-drained soils are sandy and loamy soils (most …
Echinophyllia sp. sc22
Did you know?
WebEchinophyllia sp. SC22: CYG 496/518 39,094 0.77 89 % ND ND ND 488 405 bsDronpa (M) Dronpa [22G] Echinophyllia sp. SC22: CYG 460/504 45,000 ... WebDec 21, 2004 · Disclaimer Any medical or genetic information present in this entry is provided for research, educational and informational purposes only. It is not in any way intended to be used as a substitute for professional …
WebSpecies: Echinophyllia sp. SC22 [TaxId:301887] Gene: Dronpa Database cross-references and differences (RAF-indexed): Uniprot Q5TLG6 (3-End) Domains in SCOPe 2.08: d2z1oc_ Chain 'D': Compound: Fluorescent protein Dronpa Species: Echinophyllia sp. SC22 [TaxId:301887] Gene: Dronpa Database cross-references and differences (RAF … WebLight & Temperature. Antisyphilitica euphorbia grows equally well in partial shade or full sun. It is extremely heat tolerant, and it can tolerate cold temperatures down to 28° …
WebAbstract Proteins homologous to the green fluorescent protein (GFPs) form a large family of unconventional, genetically encoded fluorophores with widely diverse colors and applications, which have profoundly renewed the fields of … WebDronpa is a photoswitchable green fluorescent protein published in 2004, derived from Echinophyllia sp. SC22. compare. Comparison List. Add Dronpa. show comparison. clear selection. FP base. info. about FPbase …
WebSpecies: Echinophyllia sp. SC22 [TaxId:301887] Gene: Dronpa Database cross-references and differences (RAF-indexed): Uniprot Q5TLG6 (3-End) Domains in SCOPe 2.08: …
WebJan 31, 2024 · Echinophyllia sp. SC22 3 10 2 3 ND 488 405 51 rsFastLime (M) Dronpa [22G] Echinophyllia sp. SC22 52 bsDronpa (M) Dronpa [22G] Echinophyllia sp. SC22 52 rsCherryRev (M) mCherry [DsRed] Discosoma sp. rsTagRFP (M) TagRFP [eqFP578] E. quadricolor 27 mEosFP M159A (M) EosFP L. Hemprichii 3 10 2 3 1.5 3 10 2 1 488 405 41 pipelines jenkinsWebMaltaWildPlants.com is an internet online database of the wild plants growing on the islands of Malta and Gozo. . This is the profile for the plant - Echinophora spinosa / Prickly … pipelines in kyWebJan 21, 2024 · Organism(s): Echinophyllia sp. SC22; Expression System: Escherichia coli BL21(DE3) Mutation(s): Yes ; Deposited: 2024-01-21 Released: 2024-06-12 ; Deposition … haitian bokor elmerahttp://www.maltawildplants.com/APIA/Echinophora_spinosa.php pipelines in kansasWebEchinophyllia sp. SC22 Insert Size (bp) 825 Promoter EF-1a Tag / Fusion Protein. COX8A mitochondria targeting sequence (N terminal on insert) Cloning Information Cloning method Restriction Enzyme 5′ cloning site EcoRI (not destroyed) 3′ cloning site NotI (not destroyed) 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC 3 ... haitian bus hijackWebFluorescent protein Dronpa. Madej T, Lanczycki CJ, Zhang D, Thiessen PA, Geer RC, Marchler-Bauer A, Bryant SH. pipelines in sapWebEchinophyllia sp. EC Echinophyllia sp. M901 Echinophyllia sp. M905 Echinophyllia sp. M906 Echinophyllia sp. M908 Echinophyllia sp. MNHN-IK-2012-14230 Echinophyllia sp. MNHN-IK-2012-14234 Echinophyllia sp. MY350 Echinophyllia sp. SA1126 Echinophyllia sp. SA1192 Echinophyllia sp. SA778 Echinophyllia sp. SC22 … haitian business