site stats

Echinophyllia sp. sc22

WebApr 10, 2014 · rsFastLime (M) Dronpa [22G] Echinophyllia sp. SC22 CYG 496/518 39,094 0.77 89 % ND ND ND 488 405 [ 20] bsDronpa (M) Dronpa [22G] Echinophyllia sp. SC22 CYG 460/504 45,000 0.50 67 % ND ND … WebEchinophyllia sp. sc22 (2) Firefly luc (1) Hiv-1 (2) Homo sapiens (92) Mus musculus (39) Pyrophorus plagiophthalamus (1) Rattus norvegicus (6) Synthetic (56) More Filters . Plasmid Type. Empty backbone (16) …

Echinophyllia sp. SC22 in the Fluorescent Protein Database

Web2z6y is a 4 chain structure with sequence from Echinophyllia sp. sc22. Full crystallographic information is available from OCA. For a guided tour on the structure components use FirstGlance. NonStd Res: WebDiscosoma sp. (sea anemone) (4) Echinophyllia sp. sc22 (1) Gallus gallus (5) Homo sapiens (8) Mus musculus (1) Prokaryotic (4) Rattus norvegicus (9) Synthetic (87) Synthetic construct (7) More Filters . Plasmid Type. Encodes multiple inserts (4) Encodes one insert (110) Resistance Marker. Bleomycin (1) haitian bokor https://ramsyscom.com

SCOPe 2.08: Structural Classification of Proteins — extended

WebEchinophyllia sp. SC22. Similar Structures: VAST+. Download sequence data: Biological Unit for 6D38: dimeric; determined by author and by software (PISA) Molecular … WebEchinophyllia sp. SC22 Insert Size (bp) 1642 Mutation. Spontaneous mutation of calmodulin's penultimate residue to a threonine, which does not seem to perturb calcium binding Promoter t7 Tags / Fusion Proteins. A modified TorA periplasmic targeting sequence plus a histidine tag (N terminal on insert) ... WebEchinophyllia. Klunzinger, 1879 [1] Species. See text. Synonyms. Oxyphyllia Yabe & Eguchi, 1935. Echinophyllia is a genus of large polyp stony corals. Members of this … pipelines in houston tx

Addgene

Category:Dronpa :: Fluorescent Protein Database

Tags:Echinophyllia sp. sc22

Echinophyllia sp. sc22

6NQR - RCSB

WebExpression of SNAP-Tagged Cox8A in Mammalian cells. Depositor. Ana Egana , New England Biolabs. Insert. Cox8A ( COX8A Human) Use. Tags. SNAP-tag (SNAPf) Expression. WebLight: Plant Echinops in Full sun. Soil: Echinops can handle many different types of soils so long as they are well drained. Well-drained soils are sandy and loamy soils (most …

Echinophyllia sp. sc22

Did you know?

WebEchinophyllia sp. SC22: CYG 496/518 39,094 0.77 89 % ND ND ND 488 405 bsDronpa (M) Dronpa [22G] Echinophyllia sp. SC22: CYG 460/504 45,000 ... WebDec 21, 2004 · Disclaimer Any medical or genetic information present in this entry is provided for research, educational and informational purposes only. It is not in any way intended to be used as a substitute for professional …

WebSpecies: Echinophyllia sp. SC22 [TaxId:301887] Gene: Dronpa Database cross-references and differences (RAF-indexed): Uniprot Q5TLG6 (3-End) Domains in SCOPe 2.08: d2z1oc_ Chain 'D': Compound: Fluorescent protein Dronpa Species: Echinophyllia sp. SC22 [TaxId:301887] Gene: Dronpa Database cross-references and differences (RAF … WebLight & Temperature. Antisyphilitica euphorbia grows equally well in partial shade or full sun. It is extremely heat tolerant, and it can tolerate cold temperatures down to 28° …

WebAbstract Proteins homologous to the green fluorescent protein (GFPs) form a large family of unconventional, genetically encoded fluorophores with widely diverse colors and applications, which have profoundly renewed the fields of … WebDronpa is a photoswitchable green fluorescent protein published in 2004, derived from Echinophyllia sp. SC22. compare. Comparison List. Add Dronpa. show comparison. clear selection. FP base. info. about FPbase …

WebSpecies: Echinophyllia sp. SC22 [TaxId:301887] Gene: Dronpa Database cross-references and differences (RAF-indexed): Uniprot Q5TLG6 (3-End) Domains in SCOPe 2.08: …

WebJan 31, 2024 · Echinophyllia sp. SC22 3 10 2 3 ND 488 405 51 rsFastLime (M) Dronpa [22G] Echinophyllia sp. SC22 52 bsDronpa (M) Dronpa [22G] Echinophyllia sp. SC22 52 rsCherryRev (M) mCherry [DsRed] Discosoma sp. rsTagRFP (M) TagRFP [eqFP578] E. quadricolor 27 mEosFP M159A (M) EosFP L. Hemprichii 3 10 2 3 1.5 3 10 2 1 488 405 41 pipelines jenkinsWebMaltaWildPlants.com is an internet online database of the wild plants growing on the islands of Malta and Gozo. . This is the profile for the plant - Echinophora spinosa / Prickly … pipelines in kyWebJan 21, 2024 · Organism(s): Echinophyllia sp. SC22; Expression System: Escherichia coli BL21(DE3) Mutation(s): Yes ; Deposited: 2024-01-21 Released: 2024-06-12 ; Deposition … haitian bokor elmerahttp://www.maltawildplants.com/APIA/Echinophora_spinosa.php pipelines in kansasWebEchinophyllia sp. SC22 Insert Size (bp) 825 Promoter EF-1a Tag / Fusion Protein. COX8A mitochondria targeting sequence (N terminal on insert) Cloning Information Cloning method Restriction Enzyme 5′ cloning site EcoRI (not destroyed) 3′ cloning site NotI (not destroyed) 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC 3 ... haitian bus hijackWebFluorescent protein Dronpa. Madej T, Lanczycki CJ, Zhang D, Thiessen PA, Geer RC, Marchler-Bauer A, Bryant SH. pipelines in sapWebEchinophyllia sp. EC Echinophyllia sp. M901 Echinophyllia sp. M905 Echinophyllia sp. M906 Echinophyllia sp. M908 Echinophyllia sp. MNHN-IK-2012-14230 Echinophyllia sp. MNHN-IK-2012-14234 Echinophyllia sp. MY350 Echinophyllia sp. SA1126 Echinophyllia sp. SA1192 Echinophyllia sp. SA778 Echinophyllia sp. SC22 … haitian business